Tuber Hudongense: A Critical Asian Truffle to Seek in Europe

Su Gyong Jo; Yong Nam Kim; Kuk Chol Ri; Kwang Myong Kim; Kuk Chol Jo; Il Gwang Yun; Jong Hyok Pak; In Chol Kye; Hui Won Kim

doi:doi:10.11648/j.plant.20251304.12

Research Article |

Tuber Hudongense: A Critical Asian Truffle to Seek in Europe

Su Gyong Jo, Yong Nam Kim, Kuk Chol Ri, Kwang Myong Kim, Kuk Chol Jo, Il Gwang Yun, Jong Hyok Pak, In Chol Kye, Hui Won Kim^*

Published in Plant (Volume 13, Issue 4)

Received: 8 September 2025 Accepted: 4 October 2025 Published: 31 October 2025

Views: Downloads:

Download PDF

Share This Article

Twitter
Linked In
Facebook

Abstract

Species belong to the genus Tuber (Pezizales, Ascomycota) are ectomycorrhizal (ECM) fungi that produce hypogeous fruiting establishing a symbiotic interaction with plant roots, mainly oaks and hazelnuts. Truffles are known as the gastronomically prized species, with a high market value, due to the expensive delicacies. Although these fungi are distributed worldwide, it has never been discovered in DPR Korea. In this study, we described about the first discovery of Tuber huidongense in DPR Korea. Based on the discovery of specimens of Tuber huidongense in DPR Korea which represents the first harvest of a true truffle in the country, a phylogenetic investigation was carried out to clarify the existence or otherwise of a complex of species around this truffle, hypothesized by various authors. A genetic analysis of all the ITS sequences available in public database was performed and it appeared very probable that two other species of Tuber (T. furfuraceum and T. lannaense) described in Far East Asia are later synonyms with T. huidongense. Therefore, their synonymization is proposed and the taxonomy of T. huidongense is clarified. From a geographical point of view, the species so far seems concentrated in South and East Asia. Its possible presence in Europe (Czech Republic) is considered doubtful to be confirmed.

Published in	Plant (Volume 13, Issue 4)
DOI	10.11648/j.plant.20251304.12
Page(s)	185-190
Creative Commons	This is an Open Access article, distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium or format, provided the original work is properly cited.
Copyright	Copyright © The Author(s), 2025. Published by Science Publishing Group

Keywords

Phylogenesis, Taxonomy, Synonymy, Asian Truffles

1. Introduction

True truffles are the underground fruiting bodies (ascoma pl. ascomata) of species belonging to the genus Tuber (Ascomycota, Pezizales) which live in mycorrhizal or endophytic symbiosis with the roots of many plants, both shrubs and herbaceous plants

[1]

. As for all hypogeous fungi, i.e. fungi with underground fruiting bodies, the distribution of their spores is ensured by various animals (arthropods: mainly insects, molluscs, mammals but also birds and turtles) which identify the ripe ascomata thanks to the odors emanating, feed on them and with their feces they spread them over more or less vast territories

[2]

. Some species of Tuber which have been highly appreciated since ancient times have ascomata of considerable size and important effects on health and the humor and also provide extraordinarily attractive smell and taste to humans, becoming an icon of luxury foods

[3]

The species of the genus Tuber which naturally occurred only in the northern hemisphere, are now present in forest, parks, gardens and in the specific truffle orchards of almost all continents except Antarctica, spread by several means. Especially, development of an indirect cultivation system made with planting of seedlings that their roots are inoculated with spores or mycelium of economically valuable truffles also hastened the wide spread of truffle species around the world

[4, 5]

Download: Download full-size image

Figure 1. Tuber huidongense Y. Wang. A) ascoma of T. huidonge; B) gleba; C) spores at optical microscope; D) spore at SEM.

For a long time, true truffles were considered the prerogative of Europe, where they have been a sought-after food since ancient times and where the first studies took place, but for more than a century they have also been known from Asia and North-Central America, and in recent years these last two areas have been considered central in the study of the biodiversity of the genus. In Asia, the first indigenous truffle, Tuber indicum

[6]

, was described from India. Among the specimens of this collection deposited in the Kew Herbarium, subsequently, Zhang & Minter (1988)

[7]

distinguished T. himalayense. Some other species of Tuber have occasionally been added to the check-list of Asian mushrooms and the new reports have become increasingly frequent, on a morphological basis between the last decade of the 20th century and the first years of the new millennium. A great boost to knowledge in this field has been provided by genetic analyses, and the results place the eastern area of the Asian continent as one of the three main hotspots of biodiversity for the genus Tuber. However, in this great influx of new data, some taxonomy issues have arisen. One of these concerns Tuber huidongense Y. Wang

[8]

, described based on morphology but with the type never officially characterized at the molecular level. Around this species, belonging to the clade Rufum, other taxa have been described subsequently, leading to the possibility of referring to a Huidongense complex

[9]

. What was the first finding of a true truffle in the DPR Korea, identified as Tuber huidongense gave rise to this taxonomic and biogeographical clarification on this species. Our aim was to characterize at the molecular level and to clarity taxonomically the true truffle first found in the DPR Korea.

Download: Download full-size image

Figure 2. Maximum likelihood tree obtained from the alignment of ITS nuclear rDNA region sequences. Maximum likelihood phylogenetic analysis was inferred from the ITS nrDNA sequences of Tuber huidongense and similar species (T. furfuraceum and T. lannaense) retrieved from GenBank and UNITE were included in Table 1. Type sequences underlined (KT758730 T. lannaense FJ797882 still listed as T. huidongense in GenBank). The asterisked sequences from Thailand now belong to T. lannaense. Tuber aestivum was included as an outgroup.

2. Materials and Methods

2.1. Specimens

The truffles were found in a northwest larch, Larix kaempferi Lambert 1824 [=Larix leptolepis (Sieb et Zucc.) Gord.] forest (38° 53´N, 126° 32´E, altitude 330m) on September 30^th, 2022. Specimens are preserved in the Central Institute of Mushroom (DPR Korea). Its identification took place on the morphological and molecular levels.

2.2. Morphological Analyses

Microscopic characters of spores, asci, and peridium were examined on hand-made sections or squash preparations obtained from a specimen voucher, using fluorescence microscope (Olympus, CX43, Japan), camera (Cannon, China) and SEM (Jeol, JSM-6610A, Japan). Sample was rehydrated for 10 min in 20% KOH, rinsed with sterile water, and then soaked with 3% KOH, following the procedure described by Leonardi et al. (2019)

[10]

2.3. Molecular Analysis

2.3.1. DNA Extraction, Amplification, and Sequencing

Genomic DNA from fungal tissue was extracted using a CTAB method according to the manufacturer’s protocol. Final DNA elution was performed in a volume of 100 μl elution buffer. The quality of the isolated material was determined by a UV–VIS NanoDrop One spectrophotometer or by 1% agarose gel electrophoresis. The obtained isolates were stored at −20 °C until further analysis steps.

2.3.2. Amplification of DNA

For optimization of target ITS rDNA fragment amplification, we used the primer couple ITS1F (5′- CTTGGTCATTTAGAGGAAGTAA-3′) and ITS4 (5′- TCCTCCGCTTATTGATATGC)

[11]

. For each PCR run performed, a negative control (control of reagent contamination) and a positive control with 100 ng of high-quality genomic DNA of Pleurotus sp. were always additionally made. The PCR was run under the following conditions: initial denaturation 95 °C for 15 min, denaturation 95 °C for 20 s, primer annealing 55 °C for 40 s, elongation 72 °C for 1 min and final elongation 72 °C for 10 min. The number of cycles for the reaction was 35. Each PCR was performed in a volume of 25 μl, with the following composition: 13 μl of 2×PCR master mix (Sangon, China), 1 μl (100 μM) of each primer, 9 μl of ddH₂O, 1 μl of extracted DNA. Amplification products were visualized electrophoretically on a 1.5% agarose gel with the addition of a Green DNA Gel Stain (Sangon, China).

2.3.3. Sequence Alignment and Phylogenetic Analysis

The purified PCR products were directly sequenced by ABI 3500 genetic analyzer (Thermofisher, U.S.A.) using the PCR primers mentioned above. The sequences were assembled and edited and used to query GeneBank via BLAST. For the phylogenetic analysis 21 nucleotide sequences were obtained from GenBank database in this study (Table 1). The multiple sequence alignment was carried out using MAFFT7, using the E-INS-i iterative refinement algorithm

[23]

. The final data set contained a total of 519 positions. A maximum likelihood (ML) phylogenetic tree was constructed using MEGA11, and bootstrapping algorithm for 1000 replications using the Kimura 2-parameter model with a Gamma distribution of rates among sites

[24]

. T. aestivum epitype sequence was used as outgroup.

Table 1. Accession numbers from GenBank

[12]

and UNITE

[13]

and collection localities of the specimens analysed in this study. The asterisks indicated as a new species with the name of Tuber lannaense.

Species

Accession number

Origin

Location

Reference

T. huidongense

FJ797882

ascoma

CHINA, Sichuan, Huidong

[14]

T. huidongense

FJ797878

ascoma

CHINA, Yunnan, Kunming

[14]

T. huidongense

FJ797881

ascoma

CHINA, Sichuan, Huidong

[14]

T. huidongense

FJ797883

CHINA, Sichuan, Huili

[14]

T. huidongense

FJ797877

CHINA, Yunnan, Xiangyun

[14]

T. huidongense

DQ486032

ascoma

CHINA, Sichuan, Panzhihua

[8]

T. huidongense

MH115294

ascoma

CHINA, Yunnan, Kunming

[15]

T. huidongense

JF921163

ascoma

CHINA

Fan unpublished

T. huidongense

AB873195

ECM

CHINA, Tangshan, Nanjing, Jiangsu

Zong et al. unpublished

T. huidongense

MW762782

ascoma

CHINA, Yunnan, Huize

Li & Zhao unpublished

T. huidongense

KT758731*

ascoma

THAILAND

[16]

as T. lannaense

T. huidongense

KT 758732*

ascoma

THAILAND

[16]

as T. lannaense

T. huidongense

KT758730*

ascoma

THAILAND

[16]

as T. lannaense

T. huidongense

SH1511239.08FU

soil

RUSSIAN FEDERATION, Primorsky Krai

[17]

T. huidongense

SH1305977.09FU

soil

INDIA, Dehradun

[18]

T. huidongense

PP555864

ascoma

DPR KOREA,

This study

Tuber sp.3

AB553372

ascoma

JAPAN

[19]

T. furfuraceum

FJ859900

ascoma

CHINA

[14]

T. furfuraceum

GU979034

ascoma

CHINA

[20]

T. furfuraceum

FJ176920

ascoma

TAIWAN

[21]

T. aestivum

MZ423173

ascoma

ITALY

[22]

3. Results

3.1. Taxonomy and Phylogenesis

The ITS sequence obtained and the compatibility of its morphological characters allowed the collection to be identified as the one belonging to the Tuber huidongense Y. Wang species (Figure 1, Figure 2). We observed a low intraspecific variability (overall average p-distance = 0.0064) in ITS1-5.8S-ITS2 rDNA region sequences in the different sequences of T. huidongense from South, Southern-East and East Asia. The genetic distance of truffle discovered in DPR Korea with the FJ797882 sequence, considered by us the most reliable to represent the reference barcode of this species, has an average of 0.0232±0.0058, in line with the average of all available ITS sequences which is 0.0231±0.0082, varying from a minimum of 0.000 for three OTUs [the sequences FJ859900, GU979034 (T. furfuraceum) and KT758730 (T. lannaense)] aligned with FJ176920 (T. furfuraceum) and KT758731 (T. lannaense) respectively to a maximum of 0.03741 (China, MH115294), with those of T. furfuraceum, both from Taiwan (FJ176920) and from the continental China (FJ859900, GU979034) placed at values of 0.02353 and those attributable to T. lannaense have values between 0.025553 and 0.02752. While the genetic distance of the Tuber aestivum outgroup is 0.39526 (average distance 0.40585±0.00587).

3.2. Geographical Distribution

Considered an endemic species of China

[8, 14]

actually from the sequences recovered from public gene banks and from the literature, it presents a hitherto apparently disjointed range that affects many countries of East and South-East Asia, including large islands, and has also been reported as ECM fungi in Central Europe, Czekia

[25]

4. Discussion

We showed the specimens of real Tuber first found in DPR Korea, which was clarified as T. huidongense by the genetic analysis of all the ITS sequences. The type of Tuber huidongense (IFS89923) has not been officially sequenced, however, it can be reasonably assumed that the sequence FJ797882 (Table 1), from a specimen collected in the same place of holotype (IFS89923), can represent an authoritative reference

[14]

. The LSU (KU207731, KU207732, KU207733) and ITS1+ITS2 (KT758730, KT758731, KT758732) sequences first and still recorded as “Tuber huidongense” were then used by Suwannarach et al. (2016)

[16]

to describe the new species Tuber lannaense N. Suwannarach & S. Lumyong although blast results with those of T. huidongense shows the similarity of 99.81% to 99.19% and 98.80% with T. furfuraceum. These data are also confirmed by the phylogenetic tree published

[16]

for LSU and also for that relating to ITS1+ITS2 where the sequences labeled as T. lannaense (KT785730, KT 785731, KT785732) actually belong to “Uncultured bacterium clone OTU1156 16S ribosomal RNA gene”

[26]

. There was evidently an error of transcription of the actual accession numbers (KT758730, KT758731, KT758732).

The species could also be found in Europe, in fact Grydler et al. (2017)

[25]

in a survey by sequencing β-tubulin gene from tree roots collected at 322 field sites across the Czech Republic found 8 ectomycorrhiza (OTUs: KX303510, KX303511, KX303533, KX303560, KX303576, KX303578, KX303585, KX303587) with a mean similarity with the GenBank hit of 96.24 ± 0.76%. However, by blasting these Czech sequences with the Asian ones we detected a significantly lower percentage of similarity. Only the harvesting of ascomata of this Czech taxon will be able to clarify its real taxonomy.

5. Taxonomy

Based on both the morphology and genetic similarity of the ITS alone, we propose that the species Tuber huidongense should also include T. furfuraceum and T. lannaense as later synonyms:

Tuber huidongense Y. Wang, Mycotaxon 83: 191 (2002)

[8]

= Tuber furfuraceum H. T. Hu & Y. Wang, Mycotaxon 93: 155 (2005)

[27]

=Tuber lannaense N. Suwannarach & S. Lumyong, Mycological Progress 15 (8): 830 (2016)

[16]

Therefore the hypothesis of a Huidongense complex may not have any reason to exist, at least from the analysis of the ITS sequences.

Abbreviations

ECM	Ectomycorrhizal

Acknowledgments

We wish to thank the Geneticists in Branch of Biotechnology, State Academy, DPR Korea for sequence analysis. We are grateful to Anna Tereba for recording the sequence of T. huidongense from DPR Korea in GenBank. Special thanks to prof. Giovanni Pacioni, Italy, for his contribution to the improvement of this manuscript.

Author Contributions

Su Gyong Jo: Conceptualization, Supervision

Yong Nam Kim: Supervision

Kuk Chol Ri: Methodology

Kwang Myong Kim: Methodology

Kuk Chol Jo: Writing-original Draft Preparation

Il Gwang Yun: Investigation

Jong Hyok Pak: Validation

In Chol Kye: Methodology

Hui Won Kim: Writing-review and Editing

All authors read and approved the final manuscript

Funding

Not funding.

Data Availability

Research data are not shared.

Consent to Publish declaration: Not applicable.

Ethics declaration: Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

[1]	MLECZKOP, HILSZCZANKAD, KARPOWICZF, KOZAKM, LEONARDIM, ROSA-GRUSZECKAA, TEREBAA, PACIONIG (2023) Tuber wenchuanense, a holarctic truffle with a wide range of host plants and description of its ectomycorrhiza. Mycorrhiza 33; 45-58. http://doi.org/10.1007/s00572-022-01097-y
[2]	CLARIDGE AW, TRAPPE JM (2005) Sporocarp mycophagy: nutritional, behavioral, evolutionary and physiological aspects, pp. 599–611. In: Dighton, J., J. F. White & P. Oudemans (eds.). The Fungal Community - Its Organization and Role in the Ecosystem. Taylor and Francis, Boca Raton, FL, USA; http://doi.org/10.1201/9781420027891.ch29
[3]	PACINI G, RAPINO C, ZARIVI O, FALCONI A, LEONARDI M, BATTISTA N, COLAFARINA S, BONFIGLI A, MIRANDA M, BARSACCHI D, MACCARRONE M (2015) Truffles contain endocannabinoid metabolic enzymes and anandamide. Phytochemistry 110: 104–110. http://doi.org/10.1016/j.phytochem.2014.11.012
[4]	BONITO GM, GRYGASKYI AP, TRAPPE JM, VILGALYS R (2010) A global meta-analysis of Tuber ITS rDNA sequences: species diversity, host associations and long-distance dispersal. Molecular Ecology 19: 4994-5008. http://doi.org/10.1111/j.1365-294X.2010.04855.x
[5]	ZAMBONELLI A, IOTTI M, HALL I (2015). Current status of truffle cultivation: recent results and future perspectives. Italian Journal of Mycology 44(1): 31–40. http://doi.org/10.6092/issn.2465-311X/5593
[6]	COOKE MC, MASSEE G (1892) Himalayan truffles. Grevillea 20; 67.
[7]	ZHANG BC, MINTER DW (1988) Tuber himalayense sp. nov. with notes on Himalayan Truffles. Transactions of the British Mycological Society 91: 593-597. http://doi.org/10.1016/S0007-1536(88)80032-9
[8]	WANG Y, HE XY (2002) Tuber huidongense sp. nov. from China. Mycotaxon 83: 191-194.
[9]	FAN L, LI T, XU YY, YAN XY (2022) Species diversity, phylogeny, endemism and geography of the truffle genus Tuber in China based on morphological and molecular data. Persoonia 48, 2022: 175–202. http://doi.org/10.3767/persoonia.2022.48.05
[10]	LEONARDI M, Paz-Conde A, Guevara G, Salvi D, Pacioni G (2019) Two new species of Tuber previously reported as Tuber mala-codermum. Mycologia 111: 676-689. http://doi.org/10.1080/00275514.2019.1603777
[11]	WHITE TJ, BRUNS T, TAYLOR J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: a Guide to Methods and Applications 18: 315–322 (eds. Innis MA, Gelfand DH, Sninsky JJ, White TJ). Academic Press, Inc., New York.
[12]	SAYERS EW, BECKJ, BOLTONEE, BOUREXISD, BRISTERJR, CANESEK, COMEAUDC, FUNKK,, KLIMKEW, MARCHLER BA, MELISSA LM, LATHROPS, LUZ, MADDENTL, O'LEARYN, PHANL, RANGWALASH, SCHNEIDERVA, SKRIPCHENKOY, WANG J, YEJ, TRAWICKBW, PRUITTKD, SHERRYST (2021) Database resources of the National Center for Biotechnology Information. Nucleic Acids Research 49(D1): D10-D17. http://doi.org/10.1093/nar/gkaa892
[13]	ABARENKOV K, KOLJALG U, NILSSON RH (2022) UNITE: species hypotheses matching analysis. Biodiversity Information Science and Standards 6. http://doi.org/10.3897/biss.6.98356
[14]	DENG XJ, CHEN J, YU FQ, LIU PG (2009) Notes on Tuber huidongense (Tuberaceae, Ascomycota), an endemic species from China. Mycotaxon 109: 189-199.
[15]	YAN XY, FAN L, CAO JZ. (2018) Four new Tuber species added to the Rufum group from China based on morphological and molecular evidence. Mycologia 110(4): 1-9. http://doi.org/10.1080/00275514.2018.1490120
[16]	SUWANNARACH N, KUMLA J, VADTHANARAT S, RASPE O, SAISAMORN LUMYONG S (2016) Morphological and molecular evidence support a new truffle, Tuber lannaense, from Thailand. Mycological Progress 15: 827-834. http://doi.org/10.1007/s11557-016-1212-x
[17]	VASAR M, DAVISION J, NEUENKAMP L, SEPP SK, YOUNG JPW, MOORA M, ÖPIK M (2021) User-friendly bioinformatics pipeline gDAT (graphical downstream analysis tool) for analysing rDNA sequences. Molecular Ecology Resources 21: 1380–1392. http://doi.org/10.1111/1755-0998.13340
[18]	TEDERSOO L, BAHRAM M, POLME S (2014). Global diversity and geography of soil fungi. Science 346 (6213): 1256688. http://doi.org/10.1126/science.1256688
[19]	KINOSHITA A, SASAKLI H, NARA K (2011) Phylogeny and diversity of Japanese truffles (Tuber spp.) inferred from sequences of four nuclear loci. Mycologia 103: 779-794. http://doi.org/10.3852/10-138
[20]	CHEN J, GUO SX, LIU PG (2011) Species recognition and cryptic species in the Tuber indicum complex. PLOS One 6(1): e14625. http://doi.org/10.1371/journal.pone.0014625
[21]	HUANG JY, HU HT, SHEN WC (2009) Phylogenetic study of two truffles, Tuber formosanum and Tuber furfuraceum, identified from Taiwan. FEMS Microbiology Letters 294: 157–71. http://doi.org/10.1111/j.1574-6968.2009.01571.x
[22]	LEONARDI M, Iotti M, Mello A, Vizzini A, Paz-Conde A, Trappe J, Pacioni G (2021) Typification of the four most investigated and valuable truffles: Tuber aestivum Vittad., T. brochii Vittad., T. magnatum Picco and T. melanosporum Vittad. Cryptogam Mycology 41(10): 1-22.
[23]	KATOH K, STANDLEY DM. (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology Evolution 30: 772-780. http://doi.org/10.1093/molbev/mst010
[24]	KIMURA M (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal Molecular Evolution 16: 111-120. http://doi.org/10.1007/BF01731581
[25]	GRYNDLERM, ŠMILAUERP, ŠTOVICEKV, NOVAKOVA K^, HRSELOVAH, JANSA J (2017) Truffle biogeography-A case study revealing ecological niche separation of different Tuber species. Ecology and Evolution 7: 4275-4288. http://doi.org/10.1002/ece3.3017
[26]	HU, J, YANG, H, LONG X, LIU Z, RENGEL Z (2016) Pepino (Solanum muricatum) planting increased diversity and abundance of bacterial communities in karst area. Scientific Reports 6, 21938 (2016) http://doi.org/10.1038/srep21938
[27]	HU HT, WANG Y (2005) Tuber furfuraceum sp. nov. from Taiwan. Mycotaxon 93: 155-157.

Cite This Article

Plain Text BibTeX RIS

APA Style

Jo, S. G., Kim, Y. N., Ri, K. C., Kim, K. M., Jo, K. C., et al. (2025). Tuber Hudongense: A Critical Asian Truffle to Seek in Europe. Plant, 13(4), 185-190. https://doi.org/10.11648/j.plant.20251304.12

Copy | Download

ACS Style

Jo, S. G.; Kim, Y. N.; Ri, K. C.; Kim, K. M.; Jo, K. C., et al. Tuber Hudongense: A Critical Asian Truffle to Seek in Europe. Plant. 2025, 13(4), 185-190. doi: 10.11648/j.plant.20251304.12

Copy | Download

AMA Style

Jo SG, Kim YN, Ri KC, Kim KM, Jo KC, et al. Tuber Hudongense: A Critical Asian Truffle to Seek in Europe. Plant. 2025;13(4):185-190. doi: 10.11648/j.plant.20251304.12

Copy | Download

@article{10.11648/j.plant.20251304.12,
  author = {Su Gyong Jo and Yong Nam Kim and Kuk Chol Ri and Kwang Myong Kim and Kuk Chol Jo and Il Gwang Yun and Jong Hyok Pak and In Chol Kye and Hui Won Kim},
  title = {Tuber Hudongense: A Critical Asian Truffle to Seek in Europe
},
  journal = {Plant},
  volume = {13},
  number = {4},
  pages = {185-190},
  doi = {10.11648/j.plant.20251304.12},
  url = {https://doi.org/10.11648/j.plant.20251304.12},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.plant.20251304.12},
  abstract = {Species belong to the genus Tuber (Pezizales, Ascomycota) are ectomycorrhizal (ECM) fungi that produce hypogeous fruiting establishing a symbiotic interaction with plant roots, mainly oaks and hazelnuts. Truffles are known as the gastronomically prized species, with a high market value, due to the expensive delicacies. Although these fungi are distributed worldwide, it has never been discovered in DPR Korea. In this study, we described about the first discovery of Tuber huidongense in DPR Korea. Based on the discovery of specimens of Tuber huidongense in DPR Korea which represents the first harvest of a true truffle in the country, a phylogenetic investigation was carried out to clarify the existence or otherwise of a complex of species around this truffle, hypothesized by various authors. A genetic analysis of all the ITS sequences available in public database was performed and it appeared very probable that two other species of Tuber (T. furfuraceum and T. lannaense) described in Far East Asia are later synonyms with T. huidongense. Therefore, their synonymization is proposed and the taxonomy of T. huidongense is clarified. From a geographical point of view, the species so far seems concentrated in South and East Asia. Its possible presence in Europe (Czech Republic) is considered doubtful to be confirmed.
},
 year = {2025}
}

Copy | Download

TY - JOUR
T1 - Tuber Hudongense: A Critical Asian Truffle to Seek in Europe

AU - Su Gyong Jo
AU - Yong Nam Kim
AU - Kuk Chol Ri
AU - Kwang Myong Kim
AU - Kuk Chol Jo
AU - Il Gwang Yun
AU - Jong Hyok Pak
AU - In Chol Kye
AU - Hui Won Kim
Y1 - 2025/10/31
PY - 2025
N1 - https://doi.org/10.11648/j.plant.20251304.12
DO - 10.11648/j.plant.20251304.12
T2 - Plant
JF - Plant
JO - Plant
SP - 185
EP - 190
PB - Science Publishing Group
SN - 2331-0677
UR - https://doi.org/10.11648/j.plant.20251304.12
AB - Species belong to the genus Tuber (Pezizales, Ascomycota) are ectomycorrhizal (ECM) fungi that produce hypogeous fruiting establishing a symbiotic interaction with plant roots, mainly oaks and hazelnuts. Truffles are known as the gastronomically prized species, with a high market value, due to the expensive delicacies. Although these fungi are distributed worldwide, it has never been discovered in DPR Korea. In this study, we described about the first discovery of Tuber huidongense in DPR Korea. Based on the discovery of specimens of Tuber huidongense in DPR Korea which represents the first harvest of a true truffle in the country, a phylogenetic investigation was carried out to clarify the existence or otherwise of a complex of species around this truffle, hypothesized by various authors. A genetic analysis of all the ITS sequences available in public database was performed and it appeared very probable that two other species of Tuber (T. furfuraceum and T. lannaense) described in Far East Asia are later synonyms with T. huidongense. Therefore, their synonymization is proposed and the taxonomy of T. huidongense is clarified. From a geographical point of view, the species so far seems concentrated in South and East Asia. Its possible presence in Europe (Czech Republic) is considered doubtful to be confirmed.

VL - 13
IS - 4
ER -

Copy | Download

Author Information

Su Gyong Jo

Department of Breeding, Central Institute of Mushroom, Pyongyang, Democratic People’s Republic of Korea
Yong Nam Kim

Department of Daily Food, Institute of Microbiology, Pyongyang, Democratic People’s Republic of Korea
Kuk Chol Ri

Department of Breeding, Central Institute of Mushroom, Pyongyang, Democratic People’s Republic of Korea
Kwang Myong Kim

Department of Breeding, Central Institute of Mushroom, Pyongyang, Democratic People’s Republic of Korea
Kuk Chol Jo

Department of Breeding, Central Institute of Mushroom, Pyongyang, Democratic People’s Republic of Korea
Il Gwang Yun

Department of Breeding, Central Institute of Mushroom, Pyongyang, Democratic People’s Republic of Korea
Jong Hyok Pak

Department of Breeding, Central Institute of Mushroom, Pyongyang, Democratic People’s Republic of Korea
In Chol Kye

Branch of Biotechnology, Pyongyang, Democratic People’s Republic of Korea
Hui Won Kim

Department of Daily Food, Institute of Microbiology, Pyongyang, Democratic People’s Republic of Korea

Contact Email

http://orcid.org/0000-0003-3099-7115

Download PDF

Submit an Article

Figure 1

Figure 1. Tuber huidongense Y. Wang. A) ascoma of T. huidonge; B) gleba; C) spores at optical microscope; D) spore at SEM.
Figure 2

Figure 2. Maximum likelihood tree obtained from the alignment of ITS nuclear rDNA region sequences. Maximum likelihood phylogenetic analysis was inferred from the ITS nrDNA sequences of Tuber huidongense and similar species (T. furfuraceum and T. lannaense) retrieved from GenBank and UNITE were included in Table 1. Type sequences underlined (KT758730 T. lannaense FJ797882 still listed as T. huidongense in GenBank). The asterisked sequences from Thailand now belong to T. lannaense. Tuber aestivum was included as an outgroup.

Table 1

Table 1. Accession numbers from GenBank [12] and UNITE [13] and collection localities of the specimens analysed in this study. The asterisks indicated as a new species with the name of Tuber lannaense.

Plain Text BibTeX RIS

APA Style

Jo, S. G., Kim, Y. N., Ri, K. C., Kim, K. M., Jo, K. C., et al. (2025). Tuber Hudongense: A Critical Asian Truffle to Seek in Europe. Plant, 13(4), 185-190. https://doi.org/10.11648/j.plant.20251304.12

Copy | Download

ACS Style

Jo, S. G.; Kim, Y. N.; Ri, K. C.; Kim, K. M.; Jo, K. C., et al. Tuber Hudongense: A Critical Asian Truffle to Seek in Europe. Plant. 2025, 13(4), 185-190. doi: 10.11648/j.plant.20251304.12

Copy | Download

AMA Style

Jo SG, Kim YN, Ri KC, Kim KM, Jo KC, et al. Tuber Hudongense: A Critical Asian Truffle to Seek in Europe. Plant. 2025;13(4):185-190. doi: 10.11648/j.plant.20251304.12

Copy | Download

@article{10.11648/j.plant.20251304.12,
  author = {Su Gyong Jo and Yong Nam Kim and Kuk Chol Ri and Kwang Myong Kim and Kuk Chol Jo and Il Gwang Yun and Jong Hyok Pak and In Chol Kye and Hui Won Kim},
  title = {Tuber Hudongense: A Critical Asian Truffle to Seek in Europe
},
  journal = {Plant},
  volume = {13},
  number = {4},
  pages = {185-190},
  doi = {10.11648/j.plant.20251304.12},
  url = {https://doi.org/10.11648/j.plant.20251304.12},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.plant.20251304.12},
  abstract = {Species belong to the genus Tuber (Pezizales, Ascomycota) are ectomycorrhizal (ECM) fungi that produce hypogeous fruiting establishing a symbiotic interaction with plant roots, mainly oaks and hazelnuts. Truffles are known as the gastronomically prized species, with a high market value, due to the expensive delicacies. Although these fungi are distributed worldwide, it has never been discovered in DPR Korea. In this study, we described about the first discovery of Tuber huidongense in DPR Korea. Based on the discovery of specimens of Tuber huidongense in DPR Korea which represents the first harvest of a true truffle in the country, a phylogenetic investigation was carried out to clarify the existence or otherwise of a complex of species around this truffle, hypothesized by various authors. A genetic analysis of all the ITS sequences available in public database was performed and it appeared very probable that two other species of Tuber (T. furfuraceum and T. lannaense) described in Far East Asia are later synonyms with T. huidongense. Therefore, their synonymization is proposed and the taxonomy of T. huidongense is clarified. From a geographical point of view, the species so far seems concentrated in South and East Asia. Its possible presence in Europe (Czech Republic) is considered doubtful to be confirmed.
},
 year = {2025}
}

Copy | Download

TY - JOUR
T1 - Tuber Hudongense: A Critical Asian Truffle to Seek in Europe

VL - 13
IS - 4
ER -

Copy | Download